Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows …
Q1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
[NEET 2023]
🔒
Answer & explanation — PYQ Pass
Unlock · ₹149
Options are free to see. Unlock the correct answer and full explanation with Pass.
Practice more NEET Biology PYQs
See every question on Molecular Basis of Inheritance, or browse the full NEET question bank.
See all questions on Molecular Basis of Inheritance →