Molecular Basis of Inheritance

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

[NEET 2024]

In the lac operon, the z gene codes for :

[NEET 2026]

Given below are two statements:
Statement I: In the lac operon, the \(z\) gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose.
Statement II : In addition to lactose, glucose or galactose can also induce lac operon.
In the light of the above statements, choose the correct answer from the options given below:

[Re-NEET 2024]

Which of the following statements are correct with reference to packaging of DNA helix ?

A. Histones are organized to form a unit of eight molecules called histone octamer.

B. Histones are negatively charged basic proteins.

C. Histones are rich in the basic amino acid residues - lysine and arginine.

D. The positively charged DNA is wrapped around the histone octamer to form nucleosome.

E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins.

Choose the correct answer from the options given below:

Which of the following are the post - transcriptional events in an eukaryotic cell?

A. Transport of pre-mRNA to cytoplasm prior to splicing

B. Removal of introns and joining of exons.

C. Addition of methyl group at 5' end of hnRNA.

D. Addition of adenine residues at 3' end of hnRNA.

E. Base pairing of two complementary RNAs.

Choose the correct answer from the options given below :

[NEET 2025]

Given below are two statements regarding RNA polymerase in prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription.
Statement II : RNA polymerase associate transiently with 'Rho' factor to initiate transcription.
In the light of the above statements, choose the correct answer from the options given below :

[Re-NEET 2024]

Which chromosome in the human genome has the highest number of genes?

[NEET 2025]

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

[NEET 2024]

Match List I with List II :

Choose the correct answer from the options given below:

[NEET 2024]

Given below are two statements:

Statement I : In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles.
Statement II : All the three RNA polymerases in eukaryotic nucleus have different roles.
In the light of the above statements, choose the correct answer from the options given below :

[Re-NEET 2024]

Which of the following statement is correct regarding the process of replication in E.coli ?

[NEET 2024]

Which of the following statement is correct regarding the process of replication in E.coli ?

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

[NEET 2024]

Match List-I with List-II:

Choose the correct answer from the options given below:

Which of the following statements about lac-operon is correct?

[Re-NEET 2026]

Which of the following statements are correct with reference to a transcription unit?
A. Transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator.
B. The promoter is said to be located towards the 5'-end of the structural gene.
C. The promoter is a DNA sequence that provides binding site for RNA polymerase.
D. The promoter defines the template and coding strands.
E. The terminator is located towards the 3'-end of the coding strand and it defines the end of the process of transcription.
Choose the correct answer from the options given below:

[NEET 2026]

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

[NEET 2024]

Match List I with List II

Choose the correct answer from the options given below:

[NEET 2024]

Given below are two statements:
Statement I: In the lac operon, the \(z\) gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose.
Statement II : In addition to lactose, glucose or galactose can also induce lac operon.
In the light of the above statements, choose the correct answer from the options given below:

[Re-NEET 2024]

Arrange the following steps of DNA fingerprinting in a correct sequence.
A. Isolation of DNA and its digestion by restriction endonucleases.
B. Hybridisation using a labelled VNTR probe.
C. Transferring of separated DNA fragments to synthetic membranes.
D. Detection of hybridised DNA fragments by autoradiography.
E. Separation of DNA fragments by electrophoresis.
Choose the correct answer from the options given below:

[NEET 2026]

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'

[NEET 2024]

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'

[NEET 2024]

Given below are two statements:

Statement I : In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles.
Statement II : All the three RNA polymerases in eukaryotic nucleus have different roles.
In the light of the above statements, choose the correct answer from the options given below :

[Re-NEET 2024]

Which factor is important for termination of transcription?

[NEET 2025]

Given below are two statements regarding RNA polymerase in prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription.
Statement II : RNA polymerase associate transiently with 'Rho' factor to initiate transcription.
In the light of the above statements, choose the correct answer from the options given below :

[Re-NEET 2024]

Unequivocal proof that DNA is the genetic material was first proposed by

Which is the basis of genetic mapping of human genome as well as DNA finger printing?

[Re-NEET 2020]

With reference to Hershey and Chase experiments. Select the correct statements.
A. Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.
B. Viruses grown on radioactive sulphur contained radioactive proteins.
C. Viruses grown on radioactive phosphorus contained radioactive protein.
D. Viruses grown on radioactive sulphur contained radioactive DNA.
E. Viruses grown on radioactive protein contained radioactive DNA.

The genetics code that codes for Methionine is

Unequivocal proof that DNA is the genetic material was first proposed by

[NEET 2023]

Expressed Sequence Tags (ESTs) refers to:

[NEET 2023]

The term 'Nuclein' for the genetic material was used by:

Name the enzyme that facilitates opening of DNA helix during transcription.

[NEET 2020]

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as :

[NEET 2021]

If Adenine makes \(30 \%\) of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

What is the role of RNA ploymerase III in the process of transcription in eukaryotes?

[NEET 2021]

Which scientist conducted an experiment with \({ }^{32} \mathrm{P}\) and \({ }^{35} \mathrm{~S}\) labelled phages for demonstrating that DNA is the genetic material?

Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes ?

[NEET 2021]

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

[NEET 2023]

If the distance between two consecutive base pairs is \(0.34 \mathrm{~nm}\) and the total number of base pairs of a DNA double helix in a typical mammalian cell is \(6.6 \times 10^{9} \mathrm{bp}\), then the length of the DNA is approximately:

E.coli has only \( 4.6 \times 10^{6} \) base pairs and completes the process of replication within 18 minutes, then the average rate of polymerisation is aproximately

[Re-NEET 2020]

E. coli has only \(4.6 \times 10^6\) base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately-

Which of the following statements is correct?

[NEET 2020]

Which of the following RNAs is not required for the synthesis of protein?

[NEET 2021]

E.coli has only \( 4.6 \times 10^{6} \) base pairs and completes the process of replication within 18 minutes, then the average rate of polymerisation is approximately

[Re-NEET 2020]

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

[NEET 2021]

Identify the correct statement

[NEET 2021]

Given below are two statements:
Statement I : RNA mutates at a faster rate.
Statement II : Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the correct answer from the options given below :

[NEET 2023]

Which one of the following statement about histones is wrong?

Statement I: RNA being unstable, mutate at a faster rate.
Statement II: RNA can directly code for synthesis of proteins hence can easily express the characters.
In the light of the above statements, choose the correct answer from the options given below:

Which one of the following statement about histones is wrong?

[NEET 2021]

In the polynucleotide chain of DNA, a nitrogenous base is linked to the \(-\mathrm{OH}\) of:

Given below are two statements:
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :

How many different proteins does the ribosome consist of?

[NEET 2023]

The first phase of translation is:

[NEET 2020]

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

[NEET 2023]

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

[NEET 2021]

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements:

Statement I: RNA mutates at a faster rate.

Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the most appropriate answer from the options given below:

If the distance between two consecutive base pairs is \( 0.34 \mathrm{~nm} \) and the total number of base pairs of DNA double helix in a typical mammalian cell is \( 6.6 \times \) \( 10^{9} \mathrm{~bp} \). Then the length of the DNA is approximately

[NEET 2020]

E. Coli has only \(4.6 \times 10^6\) base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately: