Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5' [NEET …
Q1
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
[NEET 2024]
🔒
Answer & explanation — PYQ Pass
Unlock · ₹149
Options are free to see. Unlock the correct answer and full explanation with Pass.
Practice more NEET Biology PYQs
See every question on Molecular Basis of Inheritance, or browse the full NEET question bank.
See all questions on Molecular Basis of Inheritance →